sequence-based reagent qpcr met exon 21 (reverse primer) Search Results


90
Thermo Fisher reverse transcription primers
Reverse Transcription Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse transcription primers/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
reverse transcription primers - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Illumina Inc 21-base neutral barcodes flanked by the illumina sequencing primer sequences
21 Base Neutral Barcodes Flanked By The Illumina Sequencing Primer Sequences, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/21-base neutral barcodes flanked by the illumina sequencing primer sequences/product/Illumina Inc
Average 90 stars, based on 1 article reviews
21-base neutral barcodes flanked by the illumina sequencing primer sequences - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Bioneer Corporation psmb9-reverse
Psmb9 Reverse, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/psmb9-reverse/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
psmb9-reverse - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Bioneer Corporation hk2-reverse
Hk2 Reverse, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hk2-reverse/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
hk2-reverse - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Bioneer Corporation hif1a-forward
Hif1a Forward, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hif1a-forward/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
hif1a-forward - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Bioneer Corporation hk2-forward
Hk2 Forward, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hk2-forward/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
hk2-forward - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Bioneer Corporation rt- qpcr primer pkm2- forward
Rt Qpcr Primer Pkm2 Forward, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt- qpcr primer pkm2- forward/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
rt- qpcr primer pkm2- forward - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins sequence-based reagent qpcr met exon 21 (reverse primer)

Sequence Based Reagent Qpcr Met Exon 21 (Reverse Primer), supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence-based reagent qpcr met exon 21 (reverse primer)/product/Eurofins
Average 90 stars, based on 1 article reviews
sequence-based reagent qpcr met exon 21 (reverse primer) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins cxcr4 (reverse primer

Cxcr4 (Reverse Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cxcr4 (reverse primer/product/Eurofins
Average 90 stars, based on 1 article reviews
cxcr4 (reverse primer - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins cxcl12 (reverse primer

Cxcl12 (Reverse Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cxcl12 (reverse primer/product/Eurofins
Average 90 stars, based on 1 article reviews
cxcl12 (reverse primer - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins sequence- based reagent

Sequence Based Reagent, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence- based reagent/product/Eurofins
Average 90 stars, based on 1 article reviews
sequence- based reagent - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
baseclick GmbH edu

Edu, supplied by baseclick GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/edu/product/baseclick GmbH
Average 90 stars, based on 1 article reviews
edu - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , AGGAGCACACCAAAGGACCA , Eurofins , N/A , qPCR Met Exon 21 (reverse primer).

Techniques: In Situ, SYBR Green Assay, Sequencing